Transcript: Human NM_001323362.1

Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3GAL6), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ST3GAL6 (10402)
Length:
3496
CDS:
849..1412

Additional Resources:

NCBI RefSeq record:
NM_001323362.1
NBCI Gene record:
ST3GAL6 (10402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035500 CCTTTGCACTACTATGGGAAT pLKO.1 1281 CDS 100% 4.050 3.240 N ST3GAL6 n/a
2 TRCN0000288832 CCTTTGCACTACTATGGGAAT pLKO_005 1281 CDS 100% 4.050 3.240 N ST3GAL6 n/a
3 TRCN0000035499 CGACAGTGATTCTCACTGCTT pLKO.1 961 CDS 100% 0.264 0.211 N ST3GAL6 n/a
4 TRCN0000288762 CGACAGTGATTCTCACTGCTT pLKO_005 961 CDS 100% 0.264 0.211 N ST3GAL6 n/a
5 TRCN0000035501 CCAGCCTTAAACCTGATTTAT pLKO.1 1059 CDS 100% 15.000 10.500 N ST3GAL6 n/a
6 TRCN0000288834 CCAGCCTTAAACCTGATTTAT pLKO_005 1059 CDS 100% 15.000 10.500 N ST3GAL6 n/a
7 TRCN0000035502 TCCTCTATTATGTACTGCATT pLKO.1 521 5UTR 100% 4.950 3.465 N ST3GAL6 n/a
8 TRCN0000288835 TCCTCTATTATGTACTGCATT pLKO_005 521 5UTR 100% 4.950 3.465 N ST3GAL6 n/a
9 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 2361 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.