Transcript: Human NM_001323900.2

Homo sapiens GSG1 like (GSG1L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GSG1L (146395)
Length:
5182
CDS:
291..1340

Additional Resources:

NCBI RefSeq record:
NM_001323900.2
NBCI Gene record:
GSG1L (146395)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242696 CATCATTCGTCCATCTATTAT pLKO_005 2494 3UTR 100% 15.000 10.500 N GSG1L n/a
2 TRCN0000242698 CCTACACCAAGACGGTCATTG pLKO_005 1009 CDS 100% 10.800 7.560 N GSG1L n/a
3 TRCN0000242694 GCGAGGAGGACTTTCACTTAG pLKO_005 1195 CDS 100% 10.800 7.560 N GSG1L n/a
4 TRCN0000242697 TCTCCGAGGTGCTGTACATTC pLKO_005 709 CDS 100% 10.800 7.560 N GSG1L n/a
5 TRCN0000242695 CAATGTCATCGACGGGCTCAA pLKO_005 782 CDS 100% 4.050 2.835 N GSG1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04989 pDONR223 100% 50.4% 50.4% None 1_465del;830_883del n/a
2 ccsbBroad304_04989 pLX_304 0% 50.4% 50.4% V5 1_465del;830_883del n/a
Download CSV