Transcript: Human NM_001323979.1

Homo sapiens solute carrier family 16 member 9 (SLC16A9), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
SLC16A9 (220963)
Length:
3627
CDS:
351..1619

Additional Resources:

NCBI RefSeq record:
NM_001323979.1
NBCI Gene record:
SLC16A9 (220963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433826 CGTAGCCTCTATCTCGTATTT pLKO_005 1795 3UTR 100% 13.200 18.480 N SLC16A9 n/a
2 TRCN0000420343 GACCATTACGTGCCAGTATTT pLKO_005 464 CDS 100% 13.200 18.480 N SLC16A9 n/a
3 TRCN0000038650 CCCAGACCTATGATATTGCAT pLKO.1 1459 CDS 100% 3.000 4.200 N SLC16A9 n/a
4 TRCN0000415421 GCTGACTTCAAGTGGATTAAT pLKO_005 1179 CDS 100% 15.000 10.500 N SLC16A9 n/a
5 TRCN0000413269 ATACCATATAGCAACGATATT pLKO_005 1653 3UTR 100% 13.200 9.240 N SLC16A9 n/a
6 TRCN0000038653 CCAGAAGATCTACCAGATAAA pLKO.1 699 CDS 100% 13.200 9.240 N SLC16A9 n/a
7 TRCN0000038649 CCCAATATCTACTTTCTGTTT pLKO.1 387 CDS 100% 4.950 3.465 N SLC16A9 n/a
8 TRCN0000038651 CCTTGTATCTTTATGTTGCTA pLKO.1 1201 CDS 100% 3.000 2.100 N SLC16A9 n/a
9 TRCN0000038652 GCCCATGCCTATGGGATATTA pLKO.1 1374 CDS 100% 1.500 1.050 N SLC16A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16127 pDONR223 0% 82.9% 82.9% None 0_1ins261 n/a
2 ccsbBroad304_16127 pLX_304 0% 82.9% 82.9% V5 0_1ins261 n/a
Download CSV