Transcript: Human NM_001324105.1

Homo sapiens Kruppel like factor 8 (KLF8), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
KLF8 (11279)
Length:
8788
CDS:
681..1751

Additional Resources:

NCBI RefSeq record:
NM_001324105.1
NBCI Gene record:
KLF8 (11279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015882 CGGATTCACCAATGTGACTTT pLKO.1 1485 CDS 100% 4.950 3.960 N KLF8 n/a
2 TRCN0000015881 CCTCAGTCAGTCTGCCAAATA pLKO.1 1162 CDS 100% 13.200 9.240 N KLF8 n/a
3 TRCN0000429467 GAAGCTGCGCTGGTATCTTTC pLKO_005 1772 3UTR 100% 10.800 7.560 N KLF8 n/a
4 TRCN0000413824 GATGAGCTCACTCGCCATTTC pLKO_005 1626 CDS 100% 10.800 7.560 N KLF8 n/a
5 TRCN0000015880 CCCAGCACTGTTTAATGACAT pLKO.1 848 CDS 100% 4.950 3.465 N KLF8 n/a
6 TRCN0000015878 CGCTGCTTTATTCTTTCCAAT pLKO.1 2094 3UTR 100% 4.950 3.465 N KLF8 n/a
7 TRCN0000015879 GCCATTACAGTCCCACTCATT pLKO.1 1269 CDS 100% 4.950 3.465 N KLF8 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5232 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5232 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5230 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5230 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5230 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.