Transcript: Mouse NM_001326355.1

Mus musculus RNA binding motif protein 7 (Rbm7), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rbm7 (67010)
Length:
1814
CDS:
81..629

Additional Resources:

NCBI RefSeq record:
NM_001326355.1
NBCI Gene record:
Rbm7 (67010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001326355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123468 GCACTGTCATCACAGCGTAAA pLKO.1 661 3UTR 100% 10.800 15.120 N Rbm7 n/a
2 TRCN0000374746 ACCTAGCAGATAGACACTATA pLKO_005 701 3UTR 100% 13.200 9.240 N Rbm7 n/a
3 TRCN0000123464 GCTCCTTGTGTGCTACTTTAA pLKO.1 1049 3UTR 100% 13.200 9.240 N Rbm7 n/a
4 TRCN0000316923 GCTCCTTGTGTGCTACTTTAA pLKO_005 1049 3UTR 100% 13.200 9.240 N Rbm7 n/a
5 TRCN0000123467 GCATTCGTGAACTTCAAACAT pLKO.1 237 CDS 100% 5.625 3.938 N Rbm7 n/a
6 TRCN0000316922 GCATTCGTGAACTTCAAACAT pLKO_005 237 CDS 100% 5.625 3.938 N Rbm7 n/a
7 TRCN0000123466 GCCATACCTTTAACCAGTCTT pLKO.1 617 CDS 100% 4.950 3.465 N Rbm7 n/a
8 TRCN0000349335 GCCATACCTTTAACCAGTCTT pLKO_005 617 CDS 100% 4.950 3.465 N Rbm7 n/a
9 TRCN0000074529 GCCATGACTATGATAACAGAA pLKO.1 818 3UTR 100% 4.950 3.465 N RBM7 n/a
10 TRCN0000286689 GCCATGACTATGATAACAGAA pLKO_005 818 3UTR 100% 4.950 3.465 N RBM7 n/a
11 TRCN0000305452 CTCATCCAGACACTAACAAGC pLKO_005 867 3UTR 100% 4.050 2.835 N Rbm7 n/a
12 TRCN0000123465 CCCGAAAGATAAAGATGGCAA pLKO.1 203 CDS 100% 2.640 1.848 N Rbm7 n/a
13 TRCN0000374747 CCATGGGTCTGACTATCATTA pLKO_005 744 3UTR 100% 13.200 7.920 N Rbm7 n/a
14 TRCN0000074531 CCCTACCTAGCAGATAGACAT pLKO.1 697 3UTR 100% 4.950 6.930 N RBM7 n/a
15 TRCN0000074532 CCTACCTAGCAGATAGACATT pLKO.1 698 3UTR 100% 4.950 6.930 N RBM7 n/a
16 TRCN0000286691 CCTACCTAGCAGATAGACATT pLKO_005 698 3UTR 100% 4.950 6.930 N RBM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.