Transcript: Human NM_001329201.1

Homo sapiens islet amyloid polypeptide (IAPP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
IAPP (3375)
Length:
1909
CDS:
70..339

Additional Resources:

NCBI RefSeq record:
NM_001329201.1
NBCI Gene record:
IAPP (3375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372418 ACTAACTAAGGTCCCATAATA pLKO_005 496 3UTR 100% 15.000 21.000 N IAPP n/a
2 TRCN0000378786 AGAGGACAATGTAACTCTATA pLKO_005 338 CDS 100% 13.200 18.480 N IAPP n/a
3 TRCN0000118973 GCTACACCCATTGAAAGTCAT pLKO.1 133 CDS 100% 4.950 6.930 N IAPP n/a
4 TRCN0000118972 GCTGGTACTAAGAGGCTATTT pLKO.1 1180 3UTR 100% 13.200 9.240 N IAPP n/a
5 TRCN0000118975 AGAGGAATGCAGTAGAGGTTT pLKO.1 284 CDS 100% 4.950 3.465 N IAPP n/a
6 TRCN0000118976 CTCTCTGTTGCATTGAACCAT pLKO.1 106 CDS 100% 3.000 2.100 N IAPP n/a
7 TRCN0000118974 CAGCAACAACTTTGGTGCCAT pLKO.1 225 CDS 100% 2.640 1.848 N IAPP n/a
8 TRCN0000378754 TCTAGTGATTTCCTGTATAAT pLKO_005 374 3UTR 100% 15.000 9.000 N IAPP n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 803 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 793 3UTR 100% 13.200 6.600 Y IQCC n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 728 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 800 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.