Transcript: Human NM_001329431.2

Homo sapiens tumor protein p53 inducible nuclear protein 2 (TP53INP2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TP53INP2 (58476)
Length:
4018
CDS:
227..889

Additional Resources:

NCBI RefSeq record:
NM_001329431.2
NBCI Gene record:
TP53INP2 (58476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160047 CCAGGGAATAAGCCAAATTAA pLKO.1 2662 3UTR 100% 15.000 21.000 N TP53INP2 n/a
2 TRCN0000165135 GCACCGTGTATGAATGCAGTT pLKO.1 3542 3UTR 100% 4.050 5.670 N TP53INP2 n/a
3 TRCN0000162043 CCTAGATCCATGTGGCTTTAT pLKO.1 3683 3UTR 100% 13.200 9.240 N TP53INP2 n/a
4 TRCN0000416349 ACTATCCCATGGTTGGCATTA pLKO_005 1294 3UTR 100% 10.800 7.560 N TP53INP2 n/a
5 TRCN0000160166 CCTGTTCCCTTATTCTTCATT pLKO.1 1323 3UTR 100% 5.625 3.938 N TP53INP2 n/a
6 TRCN0000166445 CAAGAACCAGAGCAGCTTCAT pLKO.1 835 CDS 100% 4.950 3.465 N TP53INP2 n/a
7 TRCN0000164690 CCCTGAAATCTGAAGGGCTTA pLKO.1 1755 3UTR 100% 4.050 2.835 N TP53INP2 n/a
8 TRCN0000434875 TGGACGGCTGGCTCATCATTG pLKO_005 321 CDS 100% 3.600 2.520 N TP53INP2 n/a
9 TRCN0000435645 CAGCGCCAGTTCAACTACTGA pLKO_005 869 CDS 100% 3.000 2.100 N TP53INP2 n/a
10 TRCN0000161076 GCCTCTCTTTCTTTCTAGGTT pLKO.1 2163 3UTR 100% 3.000 2.100 N TP53INP2 n/a
11 TRCN0000165975 GAACCAGAGCAGCTTCATCTA pLKO.1 838 CDS 100% 4.950 2.970 N TP53INP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.