Transcript: Human NM_001329434.2

Homo sapiens nucleoporin 205 (NUP205), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
NUP205 (23165)
Length:
6275
CDS:
1114..6078

Additional Resources:

NCBI RefSeq record:
NM_001329434.2
NBCI Gene record:
NUP205 (23165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344946 CCGTGCTTATGCTCTTCTATG pLKO_005 6083 3UTR 100% 10.800 15.120 N NUP205 n/a
2 TRCN0000060025 GCAACAATTCACTCTCGTCTT pLKO.1 950 5UTR 100% 4.050 5.670 N NUP205 n/a
3 TRCN0000333826 GCAACAATTCACTCTCGTCTT pLKO_005 950 5UTR 100% 4.050 5.670 N NUP205 n/a
4 TRCN0000060027 GCCTCAATAGAGCTAAGGGTA pLKO.1 3397 CDS 100% 2.640 3.696 N NUP205 n/a
5 TRCN0000060023 GCCAGTGCTTAGGACTACTAA pLKO.1 5177 CDS 100% 5.625 4.500 N NUP205 n/a
6 TRCN0000333745 GCCAGTGCTTAGGACTACTAA pLKO_005 5177 CDS 100% 5.625 4.500 N NUP205 n/a
7 TRCN0000346378 GACCTGTTGCCTCCAACTATT pLKO_005 1546 CDS 100% 13.200 9.240 N Nup205 n/a
8 TRCN0000060024 GCTCTCAGTTTACTGGAAGAA pLKO.1 2494 CDS 100% 4.950 3.465 N NUP205 n/a
9 TRCN0000333827 GCTCTCAGTTTACTGGAAGAA pLKO_005 2494 CDS 100% 4.950 3.465 N NUP205 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.