Transcript: Human NM_001329700.2

Homo sapiens netrin 4 (NTN4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NTN4 (59277)
Length:
3552
CDS:
456..2273

Additional Resources:

NCBI RefSeq record:
NM_001329700.2
NBCI Gene record:
NTN4 (59277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370365 ACCTGTCACTTCGACGTTAAT pLKO_005 1473 CDS 100% 13.200 18.480 N NTN4 n/a
2 TRCN0000370364 CTTACGTTTGATGCTACTTAA pLKO_005 2616 3UTR 100% 13.200 18.480 N NTN4 n/a
3 TRCN0000119193 GCGCTATTTGTACTTCTAAAT pLKO.1 988 CDS 100% 13.200 18.480 N NTN4 n/a
4 TRCN0000365243 TTCCGAGGAAAGCGAACATTA pLKO_005 2064 CDS 100% 13.200 18.480 N NTN4 n/a
5 TRCN0000119192 GCACTTTACTACCTACCACTT pLKO.1 2786 3UTR 100% 4.050 5.670 N NTN4 n/a
6 TRCN0000119195 CGTTATACAATGACCGGCCAT pLKO.1 1381 CDS 100% 2.160 3.024 N NTN4 n/a
7 TRCN0000365244 TAGCAGGACATGAGGATATAA pLKO_005 2152 CDS 100% 15.000 12.000 N NTN4 n/a
8 TRCN0000365242 GCACTGGAGGAGAGGTTATTT pLKO_005 1027 CDS 100% 15.000 10.500 N NTN4 n/a
9 TRCN0000370307 TTCTACTTCACTCACCTAATT pLKO_005 828 CDS 100% 13.200 9.240 N NTN4 n/a
10 TRCN0000119196 ACAGGCAAACTAATTGTGAAT pLKO.1 2175 CDS 100% 4.950 3.465 N NTN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.