Transcript: Human NM_001329728.2

Homo sapiens Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 (RAPH1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RAPH1 (65059)
Length:
3328
CDS:
192..2198

Additional Resources:

NCBI RefSeq record:
NM_001329728.2
NBCI Gene record:
RAPH1 (65059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077859 GCCAGGACTATCGGAACAAAT pLKO.1 1705 CDS 100% 13.200 18.480 N RAPH1 n/a
2 TRCN0000262118 GAGCATCTGGTATCTACTATG pLKO_005 1609 CDS 100% 10.800 15.120 N Raph1 n/a
3 TRCN0000077861 GCTTATATTTATGGAGCGTAT pLKO.1 1388 CDS 100% 4.050 5.670 N RAPH1 n/a
4 TRCN0000077862 GCGTCAAATCACAGAAACGAA pLKO.1 518 CDS 100% 3.000 4.200 N RAPH1 n/a
5 TRCN0000415429 GATGCTGAAGTACACTCTATT pLKO_005 783 CDS 100% 13.200 9.240 N RAPH1 n/a
6 TRCN0000077860 GCACCTTGAAAGGATTATCTT pLKO.1 583 CDS 100% 5.625 3.938 N RAPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.