Transcript: Human NM_001329907.2

Homo sapiens OTU deubiquitinase 7A (OTUD7A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
OTUD7A (161725)
Length:
1841
CDS:
390..1667

Additional Resources:

NCBI RefSeq record:
NM_001329907.2
NBCI Gene record:
OTUD7A (161725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050161 CGCACACACTTCAGCAAGAAT pLKO.1 1245 CDS 100% 5.625 7.875 N OTUD7A n/a
2 TRCN0000425854 ACGAGCTGTAAACGGCTTCTT pLKO_005 969 CDS 100% 4.950 6.930 N OTUD7A n/a
3 TRCN0000050158 CCATCGTTGTTGTGGCAGATA pLKO.1 1363 CDS 100% 4.950 6.930 N OTUD7A n/a
4 TRCN0000423073 GAGATGCCAATCTACACATTC pLKO_005 822 CDS 100% 10.800 7.560 N OTUD7A n/a
5 TRCN0000050159 CGAGGATTTCAGGAGCTTCAT pLKO.1 869 CDS 100% 4.950 3.465 N OTUD7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.