Transcript: Human NM_001329946.2

Homo sapiens KIAA0586 (KIAA0586), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0586 (9786)
Length:
8492
CDS:
547..5127

Additional Resources:

NCBI RefSeq record:
NM_001329946.2
NBCI Gene record:
KIAA0586 (9786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127503 CAGTGTTTATGCCACTGGTTT pLKO.1 5148 3UTR 100% 0.495 0.693 N KIAA0586 n/a
2 TRCN0000431486 ATTATGTAGCTCAAGGTTATT pLKO_005 5437 3UTR 100% 13.200 10.560 N KIAA0586 n/a
3 TRCN0000421251 AGCTTACTGTGCAGGTATTAC pLKO_005 2975 CDS 100% 13.200 9.240 N KIAA0586 n/a
4 TRCN0000127673 CCTGTGATTCGGATCATGATA pLKO.1 3794 CDS 100% 5.625 3.938 N KIAA0586 n/a
5 TRCN0000130660 CCCTAATCTTGGTAGCTGTAA pLKO.1 1452 CDS 100% 4.950 3.465 N KIAA0586 n/a
6 TRCN0000127502 CGGCAATTTGACACAGTTTCA pLKO.1 4693 CDS 100% 4.950 3.465 N KIAA0586 n/a
7 TRCN0000127906 CTCTCTCAGACTGTTTGGTTT pLKO.1 5197 3UTR 100% 4.950 3.465 N KIAA0586 n/a
8 TRCN0000130759 GCAGAGTGATTTGGAAGCAAA pLKO.1 1134 CDS 100% 4.950 3.465 N KIAA0586 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 8121 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 8121 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 7805 3UTR 100% 4.050 2.025 Y ERN2 n/a
12 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 7248 3UTR 100% 2.160 1.080 Y LOC652276 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7450 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 8119 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 8119 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 8119 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7450 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.