Transcript: Human NM_001330072.2

Homo sapiens doublecortin like kinase 1 (DCLK1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
DCLK1 (9201)
Length:
8295
CDS:
190..2412

Additional Resources:

NCBI RefSeq record:
NM_001330072.2
NBCI Gene record:
DCLK1 (9201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002148 TCTGTCGGATAACGTGAATTT pLKO.1 471 CDS 100% 13.200 18.480 N DCLK1 n/a
2 TRCN0000356153 ACCCGAACTCTGTCGGATAAC pLKO_005 463 CDS 100% 10.800 15.120 N DCLK1 n/a
3 TRCN0000195597 CGAAACGGAGATCGATACTTC pLKO.1 376 CDS 100% 4.950 6.930 N DCLK1 n/a
4 TRCN0000002146 CAGGTATCTTTGTAGCGGTTT pLKO.1 2546 3UTR 100% 4.050 5.670 N DCLK1 n/a
5 TRCN0000356154 TGATCTATCTAGCGCTCAATG pLKO_005 2498 3UTR 100% 10.800 8.640 N DCLK1 n/a
6 TRCN0000002145 GAACTGTATCTTGTCATGGAA pLKO.1 1567 CDS 100% 3.000 2.400 N DCLK1 n/a
7 TRCN0000233489 CACCTTTAGGTTACCTATATA pLKO_005 3553 3UTR 100% 15.000 10.500 N DCLK1 n/a
8 TRCN0000194785 CCATTACTTCCACTAACAAAT pLKO.1 1616 CDS 100% 13.200 9.240 N DCLK1 n/a
9 TRCN0000233486 CCATTACTTCCACTAACAAAT pLKO_005 1616 CDS 100% 13.200 9.240 N DCLK1 n/a
10 TRCN0000233485 CTACAATAACAGAACGATATA pLKO_005 1340 CDS 100% 13.200 9.240 N DCLK1 n/a
11 TRCN0000233487 GAACATCGTCCACCGTGATAT pLKO_005 1704 CDS 100% 13.200 9.240 N DCLK1 n/a
12 TRCN0000233488 GTCGATGTAGATCAGCGATTT pLKO_005 2077 CDS 100% 10.800 7.560 N DCLK1 n/a
13 TRCN0000002144 AGCTACAATAACAGAACGATA pLKO.1 1338 CDS 100% 4.950 3.465 N DCLK1 n/a
14 TRCN0000002147 GCGCCATCAAATACCTGCATA pLKO.1 1679 CDS 100% 4.950 3.465 N DCLK1 n/a
15 TRCN0000196643 GTGAGAACAATCTACACCATT pLKO.1 502 CDS 100% 4.950 3.465 N DCLK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.