Transcript: Human NM_001330306.2

Homo sapiens chromosome 1 open reading frame 159 (C1orf159), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
C1orf159 (54991)
Length:
2432
CDS:
220..1362

Additional Resources:

NCBI RefSeq record:
NM_001330306.2
NBCI Gene record:
C1orf159 (54991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330306.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414680 ACCTCAAGCGCTCCAGTAAAC pLKO_005 722 CDS 100% 10.800 15.120 N C1orf159 n/a
2 TRCN0000195768 CTCTGGATCTCAGCTGGATTT pLKO.1 1010 CDS 100% 10.800 7.560 N C1orf159 n/a
3 TRCN0000436422 ACAACGGCTCCGAGTGTAGAA pLKO_005 548 CDS 100% 4.950 3.465 N C1orf159 n/a
4 TRCN0000183078 CAGAAATTCATTGTGCAGAAA pLKO.1 1999 3UTR 100% 4.950 3.465 N C1orf159 n/a
5 TRCN0000122485 CCCGTGACTTCCATGCTCTTT pLKO.1 1063 CDS 100% 4.950 3.465 N C1orf159 n/a
6 TRCN0000179676 GCTTCCTCTTGATCTCTGTTT pLKO.1 1973 3UTR 100% 4.950 3.465 N C1orf159 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330306.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.