Transcript: Human NM_001330501.2

Homo sapiens ring finger protein 157 (RNF157), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RNF157 (114804)
Length:
4988
CDS:
254..2227

Additional Resources:

NCBI RefSeq record:
NM_001330501.2
NBCI Gene record:
RNF157 (114804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016741 CATCCCGTCTAATTCCGTGTA pLKO.1 301 CDS 100% 4.050 5.670 N RNF157 n/a
2 TRCN0000016738 GCATCCATCCTCAGAGAATAT pLKO.1 1312 CDS 100% 13.200 9.240 N RNF157 n/a
3 TRCN0000016742 GCCACGGAAGAGTTCCAGAAT pLKO.1 665 CDS 100% 4.950 3.465 N RNF157 n/a
4 TRCN0000016740 CAAGATTCTAAGGTGGCTGAA pLKO.1 1034 CDS 100% 4.050 2.835 N RNF157 n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2875 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2876 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3578 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.