Transcript: Human NM_001330589.2

Homo sapiens carnitine palmitoyltransferase 2 (CPT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CPT2 (1376)
Length:
2630
CDS:
121..2028

Additional Resources:

NCBI RefSeq record:
NM_001330589.2
NBCI Gene record:
CPT2 (1376)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235539 CCCTGCATACGGGCAGATAAA pLKO_005 1779 CDS 100% 13.200 18.480 N CPT2 n/a
2 TRCN0000235537 TTCGGGACCCTGGTTTGATAT pLKO_005 456 CDS 100% 13.200 18.480 N CPT2 n/a
3 TRCN0000003092 TCGAGCTGACTGATGCCTTAA pLKO.1 1370 CDS 100% 10.800 8.640 N CPT2 n/a
4 TRCN0000003088 GACCAGTGAGAACCGAGACAT pLKO.1 993 CDS 100% 4.950 3.960 N CPT2 n/a
5 TRCN0000235538 CTCCGTTGTTCTGAACTTTAA pLKO_005 495 CDS 100% 13.200 9.240 N CPT2 n/a
6 TRCN0000235541 TTGTCCACTTGTCCCACAATA pLKO_005 1124 CDS 100% 13.200 9.240 N CPT2 n/a
7 TRCN0000235540 TGTAGCCAGTGGGTGCTATTC pLKO_005 2391 3UTR 100% 10.800 7.560 N CPT2 n/a
8 TRCN0000003091 AGTGGGTGCTATTCTGTGAAA pLKO.1 2398 3UTR 100% 4.950 3.465 N CPT2 n/a
9 TRCN0000003090 TCTCTTGAATGATGGCCAGTT pLKO.1 330 CDS 100% 4.050 2.835 N CPT2 n/a
10 TRCN0000003089 CCAGGGCTTTGACCGACACTT pLKO.1 1698 CDS 100% 1.650 1.155 N CPT2 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2138 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2138 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2138 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.