Transcript: Human NM_001330609.1

Homo sapiens WASH complex subunit 5 (WASHC5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
WASHC5 (9897)
Length:
3856
CDS:
464..3499

Additional Resources:

NCBI RefSeq record:
NM_001330609.1
NBCI Gene record:
WASHC5 (9897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330609.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128018 GCTGGTTTCTTACTACCGATA pLKO.1 514 CDS 100% 4.050 3.240 N WASHC5 n/a
2 TRCN0000129923 GCTGAACACTTGGTATGATAT pLKO.1 2545 CDS 100% 13.200 9.240 N WASHC5 n/a
3 TRCN0000278457 GCTGAACACTTGGTATGATAT pLKO_005 2545 CDS 100% 13.200 9.240 N WASHC5 n/a
4 TRCN0000128480 GAAACTCAGTTGCTCATACAA pLKO.1 3576 3UTR 100% 5.625 3.938 N WASHC5 n/a
5 TRCN0000131227 GCTGCTCTGGAGAATCTCAAT pLKO.1 2951 CDS 100% 4.950 3.465 N WASHC5 n/a
6 TRCN0000278455 GCTGCTCTGGAGAATCTCAAT pLKO_005 2951 CDS 100% 4.950 3.465 N WASHC5 n/a
7 TRCN0000127973 GCTGTACGTGATTCTCTACTT pLKO.1 790 CDS 100% 4.950 3.465 N WASHC5 n/a
8 TRCN0000129686 CGAAGATTCAAGATTGGCAAA pLKO.1 2394 CDS 100% 4.050 2.835 N WASHC5 n/a
9 TRCN0000278454 CGAAGATTCAAGATTGGCAAA pLKO_005 2394 CDS 100% 4.050 2.835 N WASHC5 n/a
10 TRCN0000128435 GCTGATTCAAATATGGACGAT pLKO.1 554 CDS 100% 2.640 1.848 N WASHC5 n/a
11 TRCN0000278456 GCTGATTCAAATATGGACGAT pLKO_005 554 CDS 100% 2.640 1.848 N WASHC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330609.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.