Transcript: Human NM_001330628.2

Homo sapiens calpastatin (CAST), transcript variant 19, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
CAST (831)
Length:
4387
CDS:
113..2320

Additional Resources:

NCBI RefSeq record:
NM_001330628.2
NBCI Gene record:
CAST (831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073640 CGGACCTCCATGTGTAGTATA pLKO.1 1418 CDS 100% 13.200 18.480 N CAST n/a
2 TRCN0000333789 CGGACCTCCATGTGTAGTATA pLKO_005 1418 CDS 100% 13.200 18.480 N CAST n/a
3 TRCN0000073642 GCTGTGCCAGTTGAATCTAAA pLKO.1 602 CDS 100% 13.200 18.480 N CAST n/a
4 TRCN0000073641 CAGTTGAATCTAAACCGGATA pLKO.1 609 CDS 100% 4.050 5.670 N CAST n/a
5 TRCN0000333788 CAGTTGAATCTAAACCGGATA pLKO_005 609 CDS 100% 4.050 5.670 N CAST n/a
6 TRCN0000370957 TATAGGGAACTATTGGCTAAA pLKO_005 806 CDS 100% 10.800 7.560 N CAST n/a
7 TRCN0000073638 GTATCTGGTATCTGCATGTAA pLKO.1 2337 3UTR 100% 5.625 3.938 N CAST n/a
8 TRCN0000333790 GTATCTGGTATCTGCATGTAA pLKO_005 2337 3UTR 100% 5.625 3.938 N CAST n/a
9 TRCN0000073639 CCAAAGAAGAAGACCGTGAAA pLKO.1 1578 CDS 100% 4.950 3.465 N CAST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.