Transcript: Human NM_001330635.2

Homo sapiens leucine rich repeat containing 7 (LRRC7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
LRRC7 (57554)
Length:
28447
CDS:
1483..5970

Additional Resources:

NCBI RefSeq record:
NM_001330635.2
NBCI Gene record:
LRRC7 (57554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146764 CCAACCACTATTGCTAGTTTA pLKO.1 1750 CDS 100% 13.200 18.480 N LRRC7 n/a
2 TRCN0000146740 CGGAATCTTCTAAAGGTGTTA pLKO.1 4244 CDS 100% 4.950 3.960 N LRRC7 n/a
3 TRCN0000252705 AGACTTGACCTAGGCAATAAT pLKO_005 2059 CDS 100% 15.000 10.500 N Lrrc7 n/a
4 TRCN0000147187 CCTGAAGTTCTGGATCAAATA pLKO.1 2095 CDS 100% 13.200 9.240 N LRRC7 n/a
5 TRCN0000148510 CCAGCAATTTCAGTCACCATT pLKO.1 5571 CDS 100% 4.950 3.465 N LRRC7 n/a
6 TRCN0000149954 GCCAACAGTAATCCTCTCTTA pLKO.1 3862 CDS 100% 4.950 3.465 N LRRC7 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9613 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000252708 CCTCCGGACACCATTACTAAA pLKO_005 5449 CDS 100% 13.200 9.240 N Lrrc7 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 9614 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 12302 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 12302 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.