Transcript: Human NM_001330694.2

Homo sapiens centrosomal protein 78 (CEP78), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CEP78 (84131)
Length:
2707
CDS:
277..2394

Additional Resources:

NCBI RefSeq record:
NM_001330694.2
NBCI Gene record:
CEP78 (84131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072684 GCTGGGATAGATCAGTCAGAT pLKO.1 1924 CDS 100% 4.950 3.960 N CEP78 n/a
2 TRCN0000072685 CCTGCGATAAGATACAAAGAT pLKO.1 565 CDS 100% 5.625 3.938 N CEP78 n/a
3 TRCN0000072686 CCTCACCAATGAAGGAGCAAA pLKO.1 1077 CDS 100% 4.950 3.465 N CEP78 n/a
4 TRCN0000072683 GCAAAGAAACTAGGGAAACTA pLKO.1 2420 3UTR 100% 5.625 3.375 N CEP78 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.