Transcript: Human NM_001330700.1

Homo sapiens DNA topoisomerase II beta (TOP2B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
TOP2B (7155)
Length:
5485
CDS:
203..5083

Additional Resources:

NCBI RefSeq record:
NM_001330700.1
NBCI Gene record:
TOP2B (7155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233295 TGCTGCAAGCCCTCGTTATAT pLKO_005 2662 CDS 100% 15.000 21.000 N TOP2B n/a
2 TRCN0000233297 GAACTTGGACACAGGTATATA pLKO_005 3051 CDS 100% 15.000 12.000 N TOP2B n/a
3 TRCN0000233296 GTAGAGCCTGAGTGGTATATT pLKO_005 2771 CDS 100% 15.000 12.000 N TOP2B n/a
4 TRCN0000049285 CCAACTATGATGCTAGGGAAA pLKO.1 2859 CDS 100% 4.050 3.240 N TOP2B n/a
5 TRCN0000049284 GCAGCCTCTAATTGTGGCATT pLKO.1 1466 CDS 100% 4.050 3.240 N TOP2B n/a
6 TRCN0000233298 TGATGATGTAATTGACGGTTT pLKO_005 5179 3UTR 100% 4.050 3.240 N TOP2B n/a
7 TRCN0000379178 ATGCTGCAAGCCCTCGTTATA pLKO_005 2661 CDS 100% 13.200 9.240 N Top2b n/a
8 TRCN0000233294 TCGCAGTTATGTAGATCTTTA pLKO_005 1066 CDS 100% 13.200 9.240 N TOP2B n/a
9 TRCN0000049283 CCTGAATTTGACGAATGGAAA pLKO.1 2042 CDS 100% 4.950 3.465 N TOP2B n/a
10 TRCN0000049286 CCTGTGGTTATTCCAAGAGAT pLKO.1 4253 CDS 100% 4.950 3.465 N TOP2B n/a
11 TRCN0000049287 GCTGACAATAAACAGAGGGAT pLKO.1 542 CDS 100% 2.640 1.848 N TOP2B n/a
12 TRCN0000093079 GATGAAGAAGAAGATGATGAT pLKO.1 5042 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.