Transcript: Mouse NM_001330781.1

Mus musculus B9 protein domain 1 (B9d1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
B9d1 (27078)
Length:
722
CDS:
66..428

Additional Resources:

NCBI RefSeq record:
NM_001330781.1
NBCI Gene record:
B9d1 (27078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001330781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198821 CCGGATGTGTTTGGGAATGAT pLKO.1 227 CDS 100% 5.625 4.500 N B9d1 n/a
2 TRCN0000198063 CCAGAGTCTACATCTACACTA pLKO.1 323 CDS 100% 4.950 3.465 N B9d1 n/a
3 TRCN0000182008 CCATGTTTGTGCCAGAGTCTA pLKO.1 312 CDS 100% 4.950 3.465 N B9d1 n/a
4 TRCN0000146509 CTCTACTGCAAGTACTGCTTT pLKO.1 147 CDS 100% 4.950 3.465 N B9D1 n/a
5 TRCN0000274987 CTCTACTGCAAGTACTGCTTT pLKO_005 147 CDS 100% 4.950 3.465 N B9D1 n/a
6 TRCN0000198787 CCTCTTCAATGTGGTGACCAA pLKO.1 460 3UTR 100% 2.640 1.848 N B9d1 n/a
7 TRCN0000181496 GCCACAGATTGTACTCAGTGT pLKO.1 199 CDS 100% 2.640 1.848 N B9d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.