Transcript: Human NM_001331007.2

Homo sapiens SMG7 nonsense mediated mRNA decay factor (SMG7), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SMG7 (9887)
Length:
5947
CDS:
175..3687

Additional Resources:

NCBI RefSeq record:
NM_001331007.2
NBCI Gene record:
SMG7 (9887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130588 CCTCCAATGGTCAGCCTTATA pLKO.1 809 CDS 100% 13.200 9.240 N SMG7 n/a
2 TRCN0000292265 CCTCCAATGGTCAGCCTTATA pLKO_005 809 CDS 100% 13.200 9.240 N SMG7 n/a
3 TRCN0000292285 GGGAATGAAGGCTCCATAAAC pLKO_005 3705 3UTR 100% 13.200 9.240 N SMG7 n/a
4 TRCN0000127998 GCCAAGATGAGCAGCTATGTT pLKO.1 1223 CDS 100% 5.625 3.938 N SMG7 n/a
5 TRCN0000292264 GCCAAGATGAGCAGCTATGTT pLKO_005 1223 CDS 100% 5.625 3.938 N SMG7 n/a
6 TRCN0000146911 CACTTTCTAAAGCACTGGAAA pLKO.1 947 CDS 100% 4.950 3.465 N SMG7 n/a
7 TRCN0000173819 CCATAGTGAAGCCACAGTCTA pLKO.1 674 CDS 100% 4.950 3.465 N Smg7 n/a
8 TRCN0000147483 GCTGTTTATCTCACTCAGTTA pLKO.1 3929 3UTR 100% 4.950 3.465 N SMG7 n/a
9 TRCN0000149697 GCTTTCAACTCTCAGCAGTTA pLKO.1 1123 CDS 100% 4.950 3.465 N SMG7 n/a
10 TRCN0000147222 GCATTGATTATCTCTCAGCAA pLKO.1 3443 CDS 100% 2.640 1.848 N SMG7 n/a
11 TRCN0000292266 GCATTGATTATCTCTCAGCAA pLKO_005 3443 CDS 100% 2.640 1.848 N SMG7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.