Transcript: Human NM_001331010.2

Homo sapiens intersectin 1 (ITSN1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
ITSN1 (6453)
Length:
16957
CDS:
246..5396

Additional Resources:

NCBI RefSeq record:
NM_001331010.2
NBCI Gene record:
ITSN1 (6453)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233548 GATACTCAATGACCAATTAAA pLKO_005 1883 CDS 100% 15.000 21.000 N ITSN1 n/a
2 TRCN0000002009 GCACTAGCTGACATGAATAAT pLKO.1 432 CDS 100% 15.000 21.000 N ITSN1 n/a
3 TRCN0000233549 CTAACTATGTGAGGCTTAAAG pLKO_005 3385 CDS 100% 13.200 18.480 N ITSN1 n/a
4 TRCN0000328084 CTAACTATGTGAGGCTTAAAG pLKO_005 3385 CDS 100% 13.200 18.480 N Itsn1 n/a
5 TRCN0000379492 GATCAGCAGTTCCATAGTTTA pLKO_005 321 CDS 100% 13.200 18.480 N ITSN1 n/a
6 TRCN0000381212 GCAATGGATCCTCGGTGTAAA pLKO_005 4311 CDS 100% 13.200 18.480 N ITSN1 n/a
7 TRCN0000380271 TAGACTTCTTGGCCTACAATG pLKO_005 5815 3UTR 100% 10.800 15.120 N ITSN1 n/a
8 TRCN0000380413 GGCTTCTAGGGTCGCTGAAAT pLKO_005 5639 3UTR 100% 13.200 10.560 N ITSN1 n/a
9 TRCN0000002008 GCACGAATGAGAAACCAGAAA pLKO.1 2809 CDS 100% 4.950 3.960 N ITSN1 n/a
10 TRCN0000379689 ACTGAAATACAGGCAATTATT pLKO_005 911 CDS 100% 15.000 10.500 N ITSN1 n/a
11 TRCN0000379756 AGATACCCACTGATCATTAAA pLKO_005 4380 CDS 100% 15.000 10.500 N ITSN1 n/a
12 TRCN0000233550 GATGGGTCTGGTTACTATAAA pLKO_005 5715 3UTR 100% 15.000 10.500 N ITSN1 n/a
13 TRCN0000381219 TACAAGCTCAAGCCCTATATC pLKO_005 2977 CDS 100% 13.200 9.240 N ITSN1 n/a
14 TRCN0000233547 TCGAAGGCAAGAACTACTAAA pLKO_005 1601 CDS 100% 13.200 9.240 N ITSN1 n/a
15 TRCN0000233546 TCGATCTGGCAGTGGTATATC pLKO_005 1178 CDS 100% 13.200 9.240 N ITSN1 n/a
16 TRCN0000002007 CGAGCATCAGAGACCAAGAAA pLKO.1 2249 CDS 100% 5.625 3.938 N ITSN1 n/a
17 TRCN0000010675 GCTGTTTGGTTTGAGTTCTTT pLKO.1 6598 3UTR 100% 5.625 3.938 N ITSN1 n/a
18 TRCN0000002010 GCAGTTGTTTGATGAGCCGTA pLKO.1 5375 CDS 100% 2.160 1.512 N ITSN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.