Transcript: Human NM_001345999.2

Homo sapiens WD repeat domain 70 (WDR70), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
WDR70 (55100)
Length:
2811
CDS:
51..1949

Additional Resources:

NCBI RefSeq record:
NM_001345999.2
NBCI Gene record:
WDR70 (55100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167362 GTACATCTATTCAAAGAGGAT pLKO.1 1306 CDS 100% 2.640 2.112 N WDR70 n/a
2 TRCN0000168496 GACATCACAGATGCGAGTGTT pLKO.1 1386 CDS 100% 4.950 3.465 N WDR70 n/a
3 TRCN0000167917 CCAAATCATCTTCCAGGGATA pLKO.1 265 CDS 100% 4.050 2.835 N WDR70 n/a
4 TRCN0000168497 GCATCCAAAGCTGAACCAGAT pLKO.1 1421 CDS 100% 4.050 2.835 N WDR70 n/a
5 TRCN0000168210 CTCATTTGAGAGCTGTTTGCA pLKO.1 1955 3UTR 100% 3.000 2.100 N WDR70 n/a
6 TRCN0000167603 GAATCTCATTTGAGAGCTGTT pLKO.1 1951 3UTR 100% 4.050 2.430 N WDR70 n/a
7 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 450 CDS 100% 2.640 1.320 Y CCDC88B n/a
8 TRCN0000159442 GCAATGTTTGAACAAACTCAA pLKO.1 105 CDS 100% 4.950 2.475 Y GUSBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.