Transcript: Human NM_001346507.2

Homo sapiens SAM and SH3 domain containing 1 (SASH1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SASH1 (23328)
Length:
6880
CDS:
368..3394

Additional Resources:

NCBI RefSeq record:
NM_001346507.2
NBCI Gene record:
SASH1 (23328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121383 CGGCACGTTCAAGTTCATCTA pLKO.1 1456 CDS 100% 4.950 6.930 N Sash1 n/a
2 TRCN0000336278 CGGCACGTTCAAGTTCATCTA pLKO_005 1456 CDS 100% 4.950 6.930 N Sash1 n/a
3 TRCN0000165625 GCTGTCGACAATGCATTGCTA pLKO.1 2309 CDS 100% 3.000 4.200 N SASH1 n/a
4 TRCN0000159781 GCAGTAATAATTCTGACCCAA pLKO.1 912 CDS 100% 2.640 3.696 N SASH1 n/a
5 TRCN0000158935 GAAGACTTGGATGAGTTAAAT pLKO.1 1661 CDS 100% 15.000 10.500 N SASH1 n/a
6 TRCN0000164684 CCACCCTTTCACTGTGCATAT pLKO.1 3427 3UTR 100% 10.800 7.560 N SASH1 n/a
7 TRCN0000166643 CCCTCAGATTGTACCTGAAGT pLKO.1 2233 CDS 100% 4.950 3.465 N SASH1 n/a
8 TRCN0000162559 CTGTAGAAAGTCTTCGCAGTT pLKO.1 1170 CDS 100% 4.050 2.835 N SASH1 n/a
9 TRCN0000159290 GCTGTAATATACCAGTACCAA pLKO.1 6676 3UTR 100% 3.000 2.100 N SASH1 n/a
10 TRCN0000160164 CAGAGTCAGAAAGAAACTAAT pLKO.1 457 CDS 100% 13.200 7.920 N SASH1 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4830 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4908 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 4738 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4908 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.