Transcript: Mouse NM_001346514.1

Mus musculus cDNA sequence BC028528 (BC028528), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
BC028528 (229600)
Length:
814
CDS:
76..519

Additional Resources:

NCBI RefSeq record:
NM_001346514.1
NBCI Gene record:
BC028528 (229600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177048 GAAGAGGGTGATTACTATCAA pLKO.1 151 CDS 100% 5.625 7.875 N BC028528 n/a
2 TRCN0000177484 GATAGGTTGAACAGGTTGAAT pLKO.1 259 CDS 100% 5.625 7.875 N BC028528 n/a
3 TRCN0000197405 CCTAATTATGATGACTTCAGT pLKO.1 199 CDS 100% 3.000 4.200 N BC028528 n/a
4 TRCN0000176670 CCAAGTCCAAATCAGAATGAT pLKO.1 421 CDS 100% 5.625 7.313 N BC028528 n/a
5 TRCN0000198337 GTTTGAGTCAGAGGATAGGTT pLKO.1 246 CDS 100% 3.000 2.400 N BC028528 n/a
6 TRCN0000215369 CAGTCTTCATACAGAACTTAT pLKO.1 327 CDS 100% 13.200 9.240 N BC028528 n/a
7 TRCN0000437799 GAGACTACAGCCTCTTCATAC pLKO_005 307 CDS 100% 10.800 7.560 N BC028528 n/a
8 TRCN0000177072 GATTACTATCAAGTGGCATAT pLKO.1 160 CDS 100% 10.800 7.560 N BC028528 n/a
9 TRCN0000414081 AGAATCCTGTAACCACGAAAC pLKO_005 356 CDS 100% 6.000 4.200 N BC028528 n/a
10 TRCN0000443100 ACAGAACCAGTGACCACAGAA pLKO_005 385 CDS 100% 4.950 3.465 N BC028528 n/a
11 TRCN0000197406 CAAATCAGAATGATGCCATGT pLKO.1 428 CDS 100% 4.050 2.835 N BC028528 n/a
12 TRCN0000413737 CCCTAATTATGATGACTTCAG pLKO_005 198 CDS 100% 4.050 2.835 N BC028528 n/a
13 TRCN0000197443 CAGTGTAAACTTCACTGTTGA pLKO.1 216 CDS 100% 0.495 0.347 N BC028528 n/a
14 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 653 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.