Transcript: Mouse NM_001346736.1

Mus musculus tet methylcytosine dioxygenase 2 (Tet2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tet2 (214133)
Length:
9205
CDS:
383..6145

Additional Resources:

NCBI RefSeq record:
NM_001346736.1
NBCI Gene record:
Tet2 (214133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250893 TCGTGCTTTGGCCAGATTAAA pLKO_005 2558 CDS 100% 15.000 21.000 N Tet2 n/a
2 TRCN0000250892 ATGCAGTATTTCCCGAATAAT pLKO_005 2819 CDS 100% 15.000 12.000 N Tet2 n/a
3 TRCN0000250896 ATGTCCTTGTAGGACTATAAT pLKO_005 6882 3UTR 100% 15.000 12.000 N Tet2 n/a
4 TRCN0000250895 GAGCGTTCCTCAGTATCATTT pLKO_005 2290 CDS 100% 13.200 10.560 N Tet2 n/a
5 TRCN0000250894 TTCGGAGGAGAAGGGTCATAA pLKO_005 4494 CDS 100% 13.200 9.240 N Tet2 n/a
6 TRCN0000217530 CTTGTACTGTATAGGCATAAG pLKO.1 5843 CDS 100% 10.800 7.560 N Tet2 n/a
7 TRCN0000192770 CCAACTCATGGGTCAATTCTT pLKO.1 5744 CDS 100% 5.625 3.938 N Tet2 n/a
8 TRCN0000201087 CGCTGGACATTTGTCTTGAAA pLKO.1 6390 3UTR 100% 5.625 3.938 N Tet2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8504 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.