Transcript: Mouse NM_001346751.1

Mus musculus coiled-coil domain containing 28A (Ccdc28a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ccdc28a (215814)
Length:
2115
CDS:
173..751

Additional Resources:

NCBI RefSeq record:
NM_001346751.1
NBCI Gene record:
Ccdc28a (215814)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063111 GCAGGAGAAATTAGCTCGCTT pLKO.1 538 CDS 100% 2.640 3.696 N CCDC28A n/a
2 TRCN0000299229 GCAGGAGAAATTAGCTCGCTT pLKO_005 538 CDS 100% 2.640 3.696 N CCDC28A n/a
3 TRCN0000180691 GAACGATTTCCACTCTGGAAA pLKO.1 460 CDS 100% 0.495 0.693 N Ccdc28a n/a
4 TRCN0000414160 TGCAGGCGTTTGGAAATGAAT pLKO_005 483 CDS 100% 5.625 3.938 N Ccdc28a n/a
5 TRCN0000184358 GTTAGAGGAACTTCCTGAGGA pLKO.1 580 CDS 100% 2.640 1.848 N Ccdc28a n/a
6 TRCN0000195894 CTCTTGCAGAAGACCCAGATT pLKO.1 690 CDS 100% 4.950 2.970 N Ccdc28a n/a
7 TRCN0000180649 CAGAAGACCCAGATTCTGTTT pLKO.1 696 CDS 100% 0.495 0.297 N Ccdc28a n/a
8 TRCN0000063108 CGCTTGAATTTGGAGCTCTAT pLKO.1 554 CDS 100% 4.950 3.465 N CCDC28A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.