Transcript: Mouse NM_001347247.1

Mus musculus cell adhesion molecule 2 (Cadm2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Cadm2 (239857)
Length:
9692
CDS:
678..1985

Additional Resources:

NCBI RefSeq record:
NM_001347247.1
NBCI Gene record:
Cadm2 (239857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125349 CCATCCATAATGCAGGACATT pLKO.1 2173 3UTR 100% 4.950 6.930 N Cadm2 n/a
2 TRCN0000125351 GCTGATATAAGATGGTTCAAA pLKO.1 1140 CDS 100% 5.625 4.500 N Cadm2 n/a
3 TRCN0000430075 ACGTTGACCTGTGAATCTAAA pLKO_005 1410 CDS 100% 13.200 9.240 N Cadm2 n/a
4 TRCN0000434075 CGTTAGCAGCACGCTGGATTT pLKO_005 1226 CDS 100% 10.800 7.560 N Cadm2 n/a
5 TRCN0000125350 GCCGAGTATGTCCTCATTGTT pLKO.1 1596 CDS 100% 5.625 3.938 N Cadm2 n/a
6 TRCN0000125352 GCCATGCAGGTGCTAGAAATT pLKO.1 1326 CDS 100% 13.200 7.920 N Cadm2 n/a
7 TRCN0000125353 TGTTACACTGTGCTCCATATT pLKO.1 1814 CDS 100% 13.200 7.920 N Cadm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.