Transcript: Mouse NM_001347318.1

Mus musculus NIMA (never in mitosis gene a)-related expressed kinase 5 (Nek5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nek5 (330721)
Length:
2307
CDS:
104..1987

Additional Resources:

NCBI RefSeq record:
NM_001347318.1
NBCI Gene record:
Nek5 (330721)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026906 CGTGACCTACAGTCCTTGATA pLKO.1 779 CDS 100% 5.625 7.875 N Nek5 n/a
2 TRCN0000026899 CCAGTAAAGGAGAAACCGTAA pLKO.1 1695 CDS 100% 4.050 5.670 N Nek5 n/a
3 TRCN0000362302 TCACACTCTGCTGCGAATAAT pLKO_005 1513 CDS 100% 15.000 10.500 N Nek5 n/a
4 TRCN0000362377 TCATTGGGAGGAGACTAAATT pLKO_005 1108 CDS 100% 15.000 10.500 N Nek5 n/a
5 TRCN0000362375 CTCTAGGACTGAAGCATATTC pLKO_005 429 CDS 100% 13.200 9.240 N Nek5 n/a
6 TRCN0000362376 CAGTAAAGGAGAAACCGTAAT pLKO_005 1696 CDS 100% 10.800 7.560 N Nek5 n/a
7 TRCN0000026947 CCAGAAGCAGAGGGTTTCTTT pLKO.1 1442 CDS 100% 5.625 3.938 N Nek5 n/a
8 TRCN0000026942 CCACAGCTTGTTGGAGAGTTA pLKO.1 957 CDS 100% 4.950 3.465 N Nek5 n/a
9 TRCN0000026877 GCCTCAAAGAACGAAGTGATT pLKO.1 230 CDS 100% 4.950 3.465 N Nek5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.