Transcript: Mouse NM_001347397.1

Mus musculus RIKEN cDNA 2900026A02 gene (2900026A02Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-03-19
Taxon:
Mus musculus (mouse)
Gene:
2900026A02Rik (243219)
Length:
6463
CDS:
600..1757

Additional Resources:

NCBI RefSeq record:
NM_001347397.1
NBCI Gene record:
2900026A02Rik (243219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264703 GATGTCACCACACCCATAAAC pLKO_005 1766 3UTR 100% 13.200 18.480 N 2900026A02Rik n/a
2 TRCN0000264702 CAGTCACTTGTCCTCATATAC pLKO_005 1064 CDS 100% 13.200 9.240 N 2900026A02Rik n/a
3 TRCN0000264701 CCCTGCCCAGGAAGATGATTT pLKO_005 1208 CDS 100% 13.200 9.240 N 2900026A02Rik n/a
4 TRCN0000178032 GCAGTCACTTGTCCTCATATA pLKO.1 1063 CDS 100% 13.200 9.240 N 2900026A02Rik n/a
5 TRCN0000181514 GCAGAGCCTGTATGAGAATCA pLKO.1 1730 CDS 100% 4.950 3.465 N 2900026A02Rik n/a
6 TRCN0000264699 AGTCACACAGCACGTGGATGT pLKO_005 1381 CDS 100% 4.050 2.835 N 2900026A02Rik n/a
7 TRCN0000181905 GATGTTCAAGGACTCCACAGA pLKO.1 1397 CDS 100% 2.640 1.848 N 2900026A02Rik n/a
8 TRCN0000264700 GGCAGAGCCTGTATGAGAATC pLKO_005 1729 CDS 100% 10.800 6.480 N 2900026A02Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.