Transcript: Mouse NM_001347427.1

Mus musculus calcium channel, voltage-dependent, alpha 2/delta subunit 4 (Cacna2d4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cacna2d4 (319734)
Length:
5728
CDS:
97..3456

Additional Resources:

NCBI RefSeq record:
NM_001347427.1
NBCI Gene record:
Cacna2d4 (319734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254581 TAGGAACGCAATGGATATTAA pLKO_005 3939 3UTR 100% 15.000 21.000 N Cacna2d4 n/a
2 TRCN0000254584 GTGGATCGCCTGCAACAATAA pLKO_005 1446 CDS 100% 13.200 10.560 N Cacna2d4 n/a
3 TRCN0000254583 ATCTCGACTGCTTCGTCATAG pLKO_005 2702 CDS 100% 10.800 8.640 N Cacna2d4 n/a
4 TRCN0000254582 CAACACGGTGACCAGATATTC pLKO_005 384 CDS 100% 13.200 9.240 N Cacna2d4 n/a
5 TRCN0000265563 CTACTACAACTCGGTACTAAT pLKO_005 609 CDS 100% 13.200 9.240 N Cacna2d4 n/a
6 TRCN0000044396 CCTGACCAATGACTACTTCTT pLKO.1 1935 CDS 100% 4.950 3.465 N CACNA2D4 n/a
7 TRCN0000044393 GCGTACAATGACTACGTCCAT pLKO.1 1108 CDS 100% 2.640 3.696 N CACNA2D4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.