Transcript: Mouse NM_001347486.1

Mus musculus adhesion G protein-coupled receptor D1 (Adgrd1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Adgrd1 (243277)
Length:
5067
CDS:
412..3027

Additional Resources:

NCBI RefSeq record:
NM_001347486.1
NBCI Gene record:
Adgrd1 (243277)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175083 GTTTGCTATACTCAACTCTTT pLKO.1 2772 CDS 100% 4.950 6.930 N Adgrd1 n/a
2 TRCN0000173876 GCACGGCATCTACAAAGCTAA pLKO.1 2951 CDS 100% 4.950 3.465 N Adgrd1 n/a
3 TRCN0000173995 GTCTCCTGAACTCAGAGGTAA pLKO.1 2822 CDS 100% 4.950 3.465 N Adgrd1 n/a
4 TRCN0000194595 CGAAGCCTTTCAGTTCAGACA pLKO.1 2909 CDS 100% 2.640 1.848 N Adgrd1 n/a
5 TRCN0000176397 CCTCCTACATTACTTCTTCCT pLKO.1 2313 CDS 100% 2.640 1.584 N Adgrd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.