Transcript: Mouse NM_001347636.1

Mus musculus exocyst complex component 7 (Exoc7), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Exoc7 (53413)
Length:
5059
CDS:
78..2132

Additional Resources:

NCBI RefSeq record:
NM_001347636.1
NBCI Gene record:
Exoc7 (53413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191757 GCAGATGATTAAGGAACGTTT pLKO.1 1871 CDS 100% 4.950 3.960 N Exoc7 n/a
2 TRCN0000366721 GCATGTCATTGGACTCATAAA pLKO_005 2172 3UTR 100% 13.200 9.240 N Exoc7 n/a
3 TRCN0000376796 GGAGGAGACGCTGTCGTTTAT pLKO_005 140 CDS 100% 13.200 9.240 N Exoc7 n/a
4 TRCN0000377152 TCCTACACAACAACTACAATT pLKO_005 1651 CDS 100% 13.200 9.240 N Exoc7 n/a
5 TRCN0000366722 ATCCTGCCTGGACCACGTTAT pLKO_005 320 CDS 100% 10.800 7.560 N Exoc7 n/a
6 TRCN0000377154 GAACCTTCTGAAACAGTATTC pLKO_005 905 CDS 100% 10.800 7.560 N Exoc7 n/a
7 TRCN0000377153 TCGAAGAGCTGTGCAAGATTC pLKO_005 1912 CDS 100% 10.800 7.560 N Exoc7 n/a
8 TRCN0000192224 CGGAACCAAGACTTCATGAAT pLKO.1 708 CDS 100% 5.625 3.938 N Exoc7 n/a
9 TRCN0000190179 CTGGACCACGTTATCAGCTAT pLKO.1 327 CDS 100% 4.950 3.465 N Exoc7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.