Transcript: Mouse NM_001347637.1

Mus musculus transforming, acidic coiled-coil containing protein 2 (Tacc2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tacc2 (57752)
Length:
3673
CDS:
365..3208

Additional Resources:

NCBI RefSeq record:
NM_001347637.1
NBCI Gene record:
Tacc2 (57752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123976 CGGACCTGTCTAACTTTGTAA pLKO.1 2088 CDS 100% 5.625 7.875 N Tacc2 n/a
2 TRCN0000353723 CGGACCTGTCTAACTTTGTAA pLKO_005 2088 CDS 100% 5.625 7.875 N Tacc2 n/a
3 TRCN0000123975 CGGGACTTACAACTTAGACTT pLKO.1 700 CDS 100% 4.950 6.930 N Tacc2 n/a
4 TRCN0000123974 CGTCTCCTTTCACTTCCGTAT pLKO.1 3292 3UTR 100% 4.050 5.670 N Tacc2 n/a
5 TRCN0000323630 CGTCTCCTTTCACTTCCGTAT pLKO_005 3292 3UTR 100% 4.050 5.670 N Tacc2 n/a
6 TRCN0000123977 CCCTTGTGAATGCAGCAACAA pLKO.1 2340 CDS 100% 4.950 3.465 N Tacc2 n/a
7 TRCN0000323561 CCCTTGTGAATGCAGCAACAA pLKO_005 2340 CDS 100% 4.950 3.465 N Tacc2 n/a
8 TRCN0000123978 GCTGGACTACAGAAACTCCTA pLKO.1 2140 CDS 100% 2.640 1.848 N Tacc2 n/a
9 TRCN0000323560 GCTGGACTACAGAAACTCCTA pLKO_005 2140 CDS 100% 2.640 1.848 N Tacc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.