Transcript: Human NM_001348010.2

Homo sapiens coiled-coil domain containing 180 (CCDC180), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CCDC180 (100499483)
Length:
3072
CDS:
236..2947

Additional Resources:

NCBI RefSeq record:
NM_001348010.2
NBCI Gene record:
CCDC180 (100499483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128443 GCATGTGCAGAATTGTAAGAA pLKO.1 1588 CDS 100% 5.625 2.813 Y SUGT1P4-STRA6LP-CCDC180 n/a
2 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 2875 CDS 100% 5.625 2.813 Y GPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12386 pDONR223 100% 91.4% 91% None (many diffs) n/a
2 ccsbBroad304_12386 pLX_304 0% 91.4% 91% V5 (many diffs) n/a
Download CSV