Transcript: Human NM_001348163.2

Homo sapiens zinc finger family member 788, pseudogene (ZNF788P), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF788P (388507)
Length:
3869
CDS:
664..2511

Additional Resources:

NCBI RefSeq record:
NM_001348163.2
NBCI Gene record:
ZNF788P (388507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108004 CACACCTACGAACACATGAAA pLKO.1 2123 CDS 100% 5.625 3.938 N ZNF788P n/a
2 TRCN0000108003 CTGGTTTCTATCATAGACATA pLKO.1 950 CDS 100% 4.950 3.465 N ZNF788P n/a
3 TRCN0000108002 GCCTTCGAATACATGGACTAA pLKO.1 2210 CDS 100% 4.950 3.465 N ZNF788P n/a
4 TRCN0000108001 GCCTTCAGGTACATGAAGTAA pLKO.1 1376 CDS 100% 0.563 0.394 N ZNF788P n/a
5 TRCN0000108000 CCGGAGAGAAACCATGTGAAT pLKO.1 2738 3UTR 100% 4.950 2.970 N ZNF788P n/a
6 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 3161 3UTR 100% 4.950 2.475 Y LOC400464 n/a
7 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1420 CDS 100% 4.050 2.025 Y ZNF700 n/a
8 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2070 CDS 100% 13.200 6.600 Y Zfp977 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3234 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3234 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.