Transcript: Mouse NM_001348180.1

Mus musculus KN motif and ankyrin repeat domains 1 (Kank1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Kank1 (107351)
Length:
5393
CDS:
642..4478

Additional Resources:

NCBI RefSeq record:
NM_001348180.1
NBCI Gene record:
Kank1 (107351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001348180.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434601 CATGAACGATGTCGTTGTATA pLKO_005 1880 CDS 100% 13.200 18.480 N Kank1 n/a
2 TRCN0000085833 GCGGGTATGAACTAAGTGAAA pLKO.1 3661 CDS 100% 4.950 6.930 N Kank1 n/a
3 TRCN0000085834 GCTCCGGTACATCATCAACAT pLKO.1 3869 CDS 100% 4.950 6.930 N Kank1 n/a
4 TRCN0000085837 GTCGTCCATCAATTCCGTCAT pLKO.1 3269 CDS 100% 4.050 5.670 N Kank1 n/a
5 TRCN0000430121 GCTGATAATTTCCCGCTTAAA pLKO_005 4977 3UTR 100% 13.200 10.560 N Kank1 n/a
6 TRCN0000085835 CCTCTACGTATGTCCAAATAA pLKO.1 3548 CDS 100% 15.000 10.500 N Kank1 n/a
7 TRCN0000085836 CTACAGGAAATCACTTGGAAT pLKO.1 3352 CDS 100% 4.950 3.465 N Kank1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348180.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.