Transcript: Human NM_001348255.2

Homo sapiens small integral membrane protein 10 like 2B (SMIM10L2B), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SMIM10L2B (644596)
Length:
2817
CDS:
80..316

Additional Resources:

NCBI RefSeq record:
NM_001348255.2
NBCI Gene record:
SMIM10L2B (644596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16044 pDONR223 0% 71.6% 73.7% None (many diffs) n/a
2 ccsbBroad304_16044 pLX_304 0% 71.6% 73.7% V5 (many diffs) n/a
3 TRCN0000473741 GCCTTACCCCCCACCTGCTGAATA pLX_317 100% 71.6% 73.7% V5 (many diffs) n/a
Download CSV