Transcript: Human NM_001348713.1

Homo sapiens hydroxyacyl-thioester dehydratase type 2 (HTD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-17
Taxon:
Homo sapiens (human)
Gene:
HTD2 (109703458)
Length:
3266
CDS:
687..1193

Additional Resources:

NCBI RefSeq record:
NM_001348713.1
NBCI Gene record:
HTD2 (109703458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049894 CCTTTGGACATCCTAACCTAT pLKO.1 372 5UTR 100% 4.950 2.475 Y RPP14 n/a
2 TRCN0000049893 GCTGCTTATTTCGGCTGTGAA pLKO.1 222 5UTR 100% 4.950 2.475 Y RPP14 n/a
3 TRCN0000049897 GCCTTACCTTTGGACATCCTA pLKO.1 366 5UTR 100% 3.000 1.500 Y RPP14 n/a
4 TRCN0000049895 GTAGGGAACTAGTATTGGATT pLKO.1 547 5UTR 100% 0.000 0.000 Y RPP14 n/a
5 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1507 3UTR 100% 4.050 2.025 Y P3H4 n/a
6 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1507 3UTR 100% 4.050 2.025 Y ORAI2 n/a
7 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1507 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.