Transcript: Human NM_001348716.1

Homo sapiens lysine demethylase 6B (KDM6B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
KDM6B (23135)
Length:
6625
CDS:
388..5319

Additional Resources:

NCBI RefSeq record:
NM_001348716.1
NBCI Gene record:
KDM6B (23135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236677 AGTCCCACTCACCTCTATTTA pLKO_005 5885 3UTR 100% 15.000 21.000 N KDM6B n/a
2 TRCN0000360034 TCTGTACAGACCCTCGAAATC pLKO_005 3998 CDS 100% 10.800 15.120 N KDM6B n/a
3 TRCN0000095268 CCTCGTCATCTCAGTTCTCTA pLKO.1 2984 CDS 100% 4.950 3.960 N Kdm6b n/a
4 TRCN0000359976 GATCTCTATGCATCCAATATT pLKO_005 4714 CDS 100% 15.000 10.500 N KDM6B n/a
5 TRCN0000367906 GGAGACCTCGTGTGGATTAAT pLKO_005 4762 CDS 100% 15.000 10.500 N KDM6B n/a
6 TRCN0000236676 AGTGCGATGTGGAGGTGTTTA pLKO_005 5117 CDS 100% 13.200 9.240 N KDM6B n/a
7 TRCN0000236679 GCTCCGTCAACATCAACATTG pLKO_005 4577 CDS 100% 10.800 7.560 N KDM6B n/a
8 TRCN0000236678 TTGAGCACAAACGGAACTATG pLKO_005 932 CDS 100% 10.800 7.560 N KDM6B n/a
9 TRCN0000359975 AGATTCTTTCTATGGGCTTTA pLKO_005 5737 3UTR 100% 10.800 6.480 N KDM6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.