Transcript: Human NM_001349867.2

Homo sapiens phospholipase A2 group VI (PLA2G6), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PLA2G6 (8398)
Length:
3310
CDS:
758..2644

Additional Resources:

NCBI RefSeq record:
NM_001349867.2
NBCI Gene record:
PLA2G6 (8398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234565 TCGTTTCAACCAGAACGTTAA pLKO_005 2056 CDS 100% 10.800 15.120 N PLA2G6 n/a
2 TRCN0000051039 CGATCTTGACTCTGCTGAGAA pLKO.1 1425 CDS 100% 4.950 6.930 N PLA2G6 n/a
3 TRCN0000234567 CCCATCAGCTCAAACATTAAG pLKO_005 2917 3UTR 100% 13.200 9.240 N PLA2G6 n/a
4 TRCN0000238785 GGCTGACGCCCTAGTGAATTT pLKO_005 454 5UTR 100% 13.200 9.240 N PLA2G6 n/a
5 TRCN0000234566 CCGAGATCCATGAGTACAATC pLKO_005 2220 CDS 100% 10.800 7.560 N PLA2G6 n/a
6 TRCN0000182293 GAGACCGAGGTCTACATCTAT pLKO.1 2573 CDS 100% 5.625 3.938 N Pla2g6 n/a
7 TRCN0000051041 CGGCATCCAGTACTTCAGATT pLKO.1 2482 CDS 100% 4.950 3.465 N PLA2G6 n/a
8 TRCN0000051038 CCTACTTACTTCCGACCCAAT pLKO.1 2144 CDS 100% 4.050 2.835 N PLA2G6 n/a
9 TRCN0000051042 CCTCGTTTCAACCAGAACGTT pLKO.1 2054 CDS 100% 3.000 2.100 N PLA2G6 n/a
10 TRCN0000234564 AGTTCCTGAAGCGGGAGTTTG pLKO_005 1908 CDS 100% 10.800 6.480 N PLA2G6 n/a
11 TRCN0000051040 CCTAGTGAATTTCCATCAGTA pLKO.1 463 5UTR 100% 4.950 2.970 N PLA2G6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.