Transcript: Human NM_001350246.1

Homo sapiens serologically defined colon cancer antigen 8 (SDCCAG8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
SDCCAG8 (10806)
Length:
2843
CDS:
1282..2520

Additional Resources:

NCBI RefSeq record:
NM_001350246.1
NBCI Gene record:
SDCCAG8 (10806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435650 ACGACCTTGTTCATACTATTA pLKO_005 516 5UTR 100% 13.200 18.480 N SDCCAG8 n/a
2 TRCN0000128258 GAAATAGCTCAACTCAGTCAA pLKO.1 2236 CDS 100% 4.950 6.930 N SDCCAG8 n/a
3 TRCN0000421956 CTTTCCCAAACCCATACTAAT pLKO_005 1255 5UTR 100% 13.200 9.240 N SDCCAG8 n/a
4 TRCN0000130059 GCTGTTAATCAGCTCAAAGAT pLKO.1 386 5UTR 100% 5.625 3.938 N SDCCAG8 n/a
5 TRCN0000130350 GAGCTTTAGCAAGGAAGCAAA pLKO.1 2019 CDS 100% 4.950 3.465 N SDCCAG8 n/a
6 TRCN0000130332 GATAGCATTCAGCAGAGCTTT pLKO.1 2005 CDS 100% 4.950 3.465 N SDCCAG8 n/a
7 TRCN0000127683 GCACAGAGAGTTCAGAGCAAA pLKO.1 1800 CDS 100% 4.950 3.465 N SDCCAG8 n/a
8 TRCN0000415404 AGAGATATTTACATTCATCTG pLKO_005 2556 3UTR 100% 4.050 2.835 N SDCCAG8 n/a
9 TRCN0000127833 GCAGAAGCATTCACCAACTGA pLKO.1 246 5UTR 100% 3.000 2.100 N SDCCAG8 n/a
10 TRCN0000128257 GCTATTAATCAACTGGAGGAA pLKO.1 1672 CDS 100% 2.640 1.848 N SDCCAG8 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 942 5UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 943 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.