Transcript: Human NM_001350560.2

Homo sapiens HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 (HACE1), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
HACE1 (57531)
Length:
4367
CDS:
853..2799

Additional Resources:

NCBI RefSeq record:
NM_001350560.2
NBCI Gene record:
HACE1 (57531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427070 CTTAGCCTCTCTAGCAATTAT pLKO_005 988 CDS 100% 15.000 21.000 N HACE1 n/a
2 TRCN0000003413 GCTGTGCCATATACTCCAAAT pLKO.1 2653 CDS 100% 10.800 15.120 N HACE1 n/a
3 TRCN0000003414 CGGAAGGATTTGTTATGTTTA pLKO.1 3822 3UTR 100% 13.200 10.560 N HACE1 n/a
4 TRCN0000436200 TAGACAGTGGTGCTGATATTA pLKO_005 620 5UTR 100% 15.000 10.500 N HACE1 n/a
5 TRCN0000003415 GCAGATTGTCAGGATGTTATT pLKO.1 1384 CDS 100% 13.200 9.240 N HACE1 n/a
6 TRCN0000415313 TGCTACAACAAATGGTCATAA pLKO_005 963 CDS 100% 13.200 9.240 N HACE1 n/a
7 TRCN0000003417 GCCAGTACCTAAAGATTCTAA pLKO.1 926 CDS 100% 5.625 3.938 N HACE1 n/a
8 TRCN0000003416 CCAGAAATTGATGTGAGTGAT pLKO.1 2434 CDS 100% 4.950 3.465 N HACE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.