Transcript: Human NM_001350888.2

Homo sapiens adenylate kinase 7 (AK7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
AK7 (122481)
Length:
3561
CDS:
28..2151

Additional Resources:

NCBI RefSeq record:
NM_001350888.2
NBCI Gene record:
AK7 (122481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145278 ACTGCATCACATCCAACTGA pXPR_003 AGG 1192 56% 11 0.6214 AK7 AK7 77913
2 BRDN0001487047 AGCTTCCTCAACCAAAGTGA pXPR_003 AGG 211 10% 2 -0.0542 AK7 AK7 77912
3 BRDN0001146118 CGCTCTACTTACGGGGTCCA pXPR_003 GGG 493 23% 4 -0.4635 AK7 AK7 77914
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037826 GCAGGTCAACTAGACGATCAA pLKO.1 1381 CDS 100% 4.950 6.930 N AK7 n/a
2 TRCN0000037825 CGGGACATCAATATCGACGAT pLKO.1 1639 CDS 100% 2.640 3.696 N AK7 n/a
3 TRCN0000195666 CTCTTATTCAGGGCCTGAATG pLKO.1 2030 CDS 100% 1.080 1.512 N AK7 n/a
4 TRCN0000037828 CGATACATATTGATGTAGGAA pLKO.1 1700 CDS 100% 0.300 0.420 N AK7 n/a
5 TRCN0000196784 GAACCACAGATCACTTATTAT pLKO.1 2511 3UTR 100% 15.000 10.500 N AK7 n/a
6 TRCN0000037827 CCTGCTGGAGTGTGATGTTAT pLKO.1 351 CDS 100% 13.200 9.240 N AK7 n/a
7 TRCN0000196558 GAAGAAAGTCTCATCCTAATT pLKO.1 566 CDS 100% 13.200 9.240 N AK7 n/a
8 TRCN0000196499 GCATAGCTCATGAGACAAATA pLKO.1 2689 3UTR 100% 13.200 9.240 N AK7 n/a
9 TRCN0000037824 CCAAGGACTTAACGCAAGATT pLKO.1 962 CDS 100% 5.625 3.938 N AK7 n/a
10 TRCN0000333657 CCAAGGACTTAACGCAAGATT pLKO_005 962 CDS 100% 5.625 3.938 N AK7 n/a
11 TRCN0000194887 CCAATCAAGATCTGCATTCTT pLKO.1 1126 CDS 100% 5.625 3.938 N AK7 n/a
12 TRCN0000195554 CGAGGATTCTGAGGTTCCATT pLKO.1 525 CDS 100% 4.950 3.465 N AK7 n/a
13 TRCN0000344929 CGAGGATTCTGAGGTTCCATT pLKO_005 525 CDS 100% 4.950 3.465 N AK7 n/a
14 TRCN0000196361 GCAGAATATCTCTTCAAGAAC pLKO.1 2439 3UTR 100% 4.950 3.465 N AK7 n/a
15 TRCN0000344875 GCAGAATATCTCTTCAAGAAC pLKO_005 2439 3UTR 100% 4.950 3.465 N AK7 n/a
16 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2267 3UTR 100% 4.950 2.475 Y LOC387873 n/a
17 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 178 CDS 100% 4.950 2.475 Y NPM2 n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2304 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000152515 GAAGAGGAAGAGGAAGATGAT pLKO.1 181 CDS 100% 4.950 2.475 Y NPM2 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2304 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13088 pDONR223 100% 86.5% 86.4% None (many diffs) n/a
2 ccsbBroad304_13088 pLX_304 0% 86.5% 86.4% V5 (many diffs) n/a
3 ccsbBroadEn_15233 pDONR223 0% 86.5% 86.4% None (many diffs) n/a
4 ccsbBroad304_15233 pLX_304 0% 86.5% 86.4% V5 (many diffs) n/a
Download CSV