Transcript: Human NM_001351567.2

Homo sapiens cell division cycle 14B (CDC14B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CDC14B (8555)
Length:
2499
CDS:
466..1923

Additional Resources:

NCBI RefSeq record:
NM_001351567.2
NBCI Gene record:
CDC14B (8555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381974 GTGATAGACTTCGGGCCTTGA pLKO_005 1748 CDS 100% 4.050 5.670 N CDC14B n/a
2 TRCN0000380135 ACTGATGCCATTGTCAAAGAA pLKO_005 1339 CDS 100% 5.625 3.375 N CDC14B n/a
3 TRCN0000005979 CTCCTGAGACTTATATTCAAT pLKO.1 1196 CDS 100% 5.625 3.375 N CDC14B n/a
4 TRCN0000273454 CTCCTGAGACTTATATTCAAT pLKO_005 1196 CDS 100% 5.625 3.375 N CDC14B n/a
5 TRCN0000273457 CACAATGTTACTACCATTATT pLKO_005 1228 CDS 100% 15.000 7.500 Y CDC14B n/a
6 TRCN0000273455 TTGGATGCTACATGGTTATAT pLKO_005 872 CDS 100% 15.000 7.500 Y CDC14B n/a
7 TRCN0000005978 GAGTGCATCAAATGTACATTA pLKO.1 663 CDS 100% 13.200 6.600 Y CDC14B n/a
8 TRCN0000284982 GGATAATACCAGACCGATTTA pLKO_005 1118 CDS 100% 13.200 6.600 Y CDC14B n/a
9 TRCN0000047130 CTGGTGGATTGTTTGTGACTA pLKO.1 1854 CDS 100% 4.950 2.475 Y CDC14C n/a
10 TRCN0000047132 TGTGTAGTGTTGTCATCTGGT pLKO.1 1838 CDS 100% 2.640 1.320 Y CDC14C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.