Transcript: Human NM_001351658.2

Homo sapiens solute carrier family 39 member 14 (SLC39A14), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLC39A14 (23516)
Length:
4842
CDS:
296..1804

Additional Resources:

NCBI RefSeq record:
NM_001351658.2
NBCI Gene record:
SLC39A14 (23516)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352988 GAGCGACGGCCTCCATAATTT pLKO_005 1351 CDS 100% 15.000 21.000 N SLC39A14 n/a
2 TRCN0000038451 GCAGGATCTAATACATCGGTA pLKO.1 457 CDS 100% 2.640 3.696 N SLC39A14 n/a
3 TRCN0000344147 TCAACCCTCTGGAAGATTATT pLKO_005 963 CDS 100% 15.000 10.500 N SLC39A14 n/a
4 TRCN0000344145 AGTCTGTTTAATTGCCTATTA pLKO_005 2304 3UTR 100% 13.200 9.240 N SLC39A14 n/a
5 TRCN0000344152 TCCTTCCTGCAGGATCTAATA pLKO_005 449 CDS 100% 13.200 9.240 N SLC39A14 n/a
6 TRCN0000344146 GGAACCTCTCCACGTGCTTTA pLKO_005 582 CDS 100% 10.800 7.560 N SLC39A14 n/a
7 TRCN0000038449 CCCTTTGTCTTGGAGTAGAAT pLKO.1 3863 3UTR 100% 5.625 3.938 N SLC39A14 n/a
8 TRCN0000038450 GCTGGAGGAATGTTCTTGTAT pLKO.1 1619 CDS 100% 5.625 3.938 N SLC39A14 n/a
9 TRCN0000110859 CCTCTACTCCAACGCCCTCTT pLKO.1 916 CDS 100% 1.350 0.945 N Slc39a14 n/a
10 TRCN0000353976 CCTCTACTCCAACGCCCTCTT pLKO_005 916 CDS 100% 1.350 0.945 N Slc39a14 n/a
11 TRCN0000038452 CCTGACTGGATTCACCATCAT pLKO.1 1741 CDS 100% 4.950 2.970 N SLC39A14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.