Transcript: Human NM_001351732.2

Homo sapiens ZNF660-ZNF197 readthrough (ZNF660-ZNF197), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF660-ZNF197 (110354863)
Length:
7575
CDS:
235..3324

Additional Resources:

NCBI RefSeq record:
NM_001351732.2
NBCI Gene record:
ZNF660-ZNF197 (110354863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 2923 CDS 100% 15.000 7.500 Y Gm10771 n/a
2 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 2923 CDS 100% 15.000 7.500 Y ZNF286B n/a
3 TRCN0000234350 AGACCTCCCACCTACACTTTA pLKO_005 350 CDS 100% 13.200 6.600 Y ZNF197 n/a
4 TRCN0000217954 AGTTACCGCTCAAACCTTATA pLKO_005 2716 CDS 100% 13.200 6.600 Y ZNF197 n/a
5 TRCN0000234353 ATAGAATCCCTGCCTACTTAA pLKO_005 3343 3UTR 100% 13.200 6.600 Y ZNF197 n/a
6 TRCN0000018054 CCACCTACACTTTAGACAATT pLKO.1 357 CDS 100% 13.200 6.600 Y ZNF197 n/a
7 TRCN0000234351 GACTTTCGGTTCAGCTATTTC pLKO_005 1287 CDS 100% 13.200 6.600 Y ZNF197 n/a
8 TRCN0000234352 TCGAGCCTTCTAATGCATTTA pLKO_005 1465 CDS 100% 13.200 6.600 Y ZNF197 n/a
9 TRCN0000018053 CCCAACTTTCAAGTCTACAAA pLKO.1 3761 3UTR 100% 5.625 2.813 Y ZNF197 n/a
10 TRCN0000018055 CGGTTCAAACAGAAACCTCAT pLKO.1 2295 CDS 100% 4.050 2.025 Y ZNF197 n/a
11 TRCN0000018056 CGCTCAAACCTTATAGCCCAT pLKO.1 2722 CDS 100% 2.160 1.080 Y ZNF197 n/a
12 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3548 3UTR 100% 13.200 6.600 Y IQCC n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3481 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 964 CDS 100% 13.200 6.600 Y Zfp874a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.