Transcript: Human NM_001352061.2

Homo sapiens cancer susceptibility 1 (CASC1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CASC1 (55259)
Length:
2581
CDS:
292..2322

Additional Resources:

NCBI RefSeq record:
NM_001352061.2
NBCI Gene record:
CASC1 (55259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005918 CCTCCACTTACAAACTGTATT pLKO.1 2323 CDS 100% 13.200 18.480 N CASC1 n/a
2 TRCN0000413834 AGGAGGAACAAGGTGATATTG pLKO_005 1124 CDS 100% 13.200 9.240 N CASC1 n/a
3 TRCN0000418962 GAGCAAGTGGAACCTACTATG pLKO_005 2001 CDS 100% 10.800 7.560 N CASC1 n/a
4 TRCN0000005915 GCATGGTGAAAGACAGGTATT pLKO.1 2362 3UTR 100% 10.800 7.560 N CASC1 n/a
5 TRCN0000005917 CCCTGTTTCAACACCATCAAA pLKO.1 963 CDS 100% 5.625 3.938 N CASC1 n/a
6 TRCN0000005916 CCTTGATTCAAGATGCTCATA pLKO.1 1643 CDS 100% 4.950 3.465 N CASC1 n/a
7 TRCN0000010977 GCCCAAGAAATGAACACGTTT pLKO.1 499 CDS 100% 4.950 3.465 N CASC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12194 pDONR223 100% 99.9% 99.8% None 1778C>A n/a
2 ccsbBroad304_12194 pLX_304 0% 99.9% 99.8% V5 1778C>A n/a
3 TRCN0000475818 GCTGGTGTATTTCCTAAACTTGTT pLX_317 21.3% 99.9% 99.8% V5 1778C>A n/a
4 ccsbBroadEn_03567 pDONR223 100% 94.3% 94.2% None 0_1ins120;1778C>A n/a
5 ccsbBroad304_03567 pLX_304 0% 94.3% 94.2% V5 0_1ins120;1778C>A n/a
Download CSV